and expression strains 5. Design of cloning procedures using the VNTI
program
Advantages
• Fast growth • Cheap medium and equipment for growing • Good knowledge of the host
RBS
RBS 5-9 n START
GAAGGAATTCAGGAGCCCTTCACCATG ... ...
START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others STOP codons: TAG (UAG), TGA (UGA), TAA (UAA)
Combinations
Genetic Elements Essential for Expression
Replication Origin
Plasmid pBR322
pUC pACYC pSC101 colE1
Replicon pMB1 pUC p15A pSC101 colE1
Copy Number 15-20
Key features
Plac Low level up to middle (IPTG)
Ptac Ptrc
Moderately high (IPTG)
(trp-lac)
Weak, regulated. Suitable for expression of gene products at very low intracellular level. Comparatively expensive induction.
Key features
T7 Very high
Utilizes T7 RNA polymerase.
T5 High
PL Moderately high (temperature shift)
Utilizes E. coli RNA polymerase.
Temperature-sensitive host required. Less likelihood of "leaky" un-induced expression. Basal level; high basal level by temperatures below 30°C. No inducer.
500-700 18-22 5 15-20
Co-expression from two plasmids
Protein Expression in Bacteria Part2
1. Cloning strategies
2. Overview of the available expression systems and expression strains
Transcriptional vector
ApaLI (1121)
pTrc99
Translational vector
pQE
Translational vector + CDR
pET
pCR&pEXP
pBAD
Expression strains
# Strain
Key features
1 BL21
We may fuse the target protein with • various tags to facilitate its purification or detection
HHHHHH-target, epitope-target • highly soluble proteins to improve solubility and to
5 BL21-AI
#1 + carry T7 polymerase under PPBAD (araBAD) Enables T7 expression with tight regulation
6 BL21 CodonPlus- #1 + Enhances the expression of eukaryotic proteins that
Deficient in lon and ompT proteases
2 BL21* /STAR
#1 + deficient in RNaseE
Improves the stability of mRNA transcripts and increases
protein expression yield
Goals
To obtain
as much as possible /good expression+good cell growth
soluble folded protein
/reduced aggregation
in a form that is easy to purify /use of secretion and tags
Genetic Elements Essential for Expression
Promoters
Host’s promoters
2500 in the entire genome of E. coli K12 strain Most frequently used: Plac / Ptac / Ptrc, PPBAD, rhaPBAD - Regulation of expression
RIL
contain codons rarely used in E. coli: AGG, AGA, AUA, CUA
7 BL21 trxB
#1 + deficient of trxB
Facilitates cytoplasmic disulfide bond formation
Expression optimization
High-level, but lower than T7 system. Regulated expression still paratively expensive induction. High basal level.
PPBAD: Regulation
PPBAD and RhaPBAD
3. Design of cloning procedures using the VNTI program
Types of Expression Vectors
1 2
3
Insertion into Transcriptional Vectors
Insertion into Translational Vectors
•differences in post-translational modifications (SS bonds, glycosylation etc)
Disadvantages
Accumulation of lipopolysaccharides (generally referred to as endotoxins) …
Cloning Using Restriction Enzymes
NcoI
HindIII
Cloning Using A-overhangs
TA-Cloning with Topoisomerase
Directional Cloning
CACC
Gateway Technology
Expression of Fusion Proteins
rhaPBAD
Variable from low to high level
(L-rhamnose)
Tight regulation. Low basal activity. Relatively expensive inducer.
Phage Promoters
Level of expression (inductor)
3 BL21*(DE3)
#1 or 2 + carry T7 polymerase under Plac
Enables T7 expression
4 BL21*(DE3)pLysS/E #3 + plasmid pLysS or pLysE expressing T7 lysozyme
Reduces basal expression of recombinant genes
Promoters from phages
T7, T3, SP6, T5, PL - Highly efficient and specific expression
Plac: Regulation
Plac, Ptac, Ptrc: Characteristics
Level of expression (inductor)
Disadvantages
Limitation for expression of eukaryotic proteins due to:
•different frequencies with which the different codons appear in genes of these organisms
facilitate purification Thioredoxin-target, GST-target
• signal peptides or other proteins or domains to promote secretion SP-target
‘Short’ Fusion Protein Construction
E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs.